snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR33
sequence
AAGCTTAATGCCCTCTTTGTACGATGGTGTCACTCTAAAATTATTTACGTAATTTAATT
GGATGTGATATCAAGCACTAGTTTTGTTTGGAGGAGCAGAGATTGAAAGCCTAGCTTTTA
CACCGGTTTGAGTCGGTTCCTTCGTTTTCTTAGTTGGAATTGATATAGAAGTGTGTGGAC
AATC
  Box motif
  Complementary to target RNA
length 183
organism Saccharomyces_cerevisiae
snoRNA name snR33
alias
chromosome ⁄ contig III
locus ⁄ host gene Mono:3:snR33
organization Mono
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U1042
accession no BK006937,L22435
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved