snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR8
sequence
ATGATACATATTAAACATGCCTTCTATTCACTGTGCCATCTTACATCCGTAGGTGATCA
GAGGGGAAAAGAAGAGCTAGAGCAACTCCCACACTCATGAGCGTCCTCATACTGTTCTGG
GCGCTTCTCACAGGTGCTTCTTTTAGTGTCTCCCATTGGCCCAGATCGGTACTGCGCGAG
TGAGATATCT
  Box motif
  Complementary to target RNA
length 189
organism Saccharomyces_cerevisiae
snoRNA name snR8
alias
chromosome ⁄ contig XV
locus ⁄ host gene Mono:42:snR8
organization Mono
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U960,25S:U986
accession no BK006948
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved