snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR34
sequence
GAATCAAAAATTTATTTTTTACACGGAAACGATGCCACAGTTGACTGAACCTGTCTTCT
AACAGTAGTTAATTGCCAGTATTTCAAACAAGATTTGAAATACGAGTTTCCCAGAATAAT
TTATTTGGACAGGATAGGAAGTCCGATTTCTGTGTTGTCTCAAACGAGGCGATAGAATTG
GGATGTCGAAGAAAGTCTACATTA
  Box motif
  Complementary to target RNA
length 203
organism Saccharomyces_cerevisiae
snoRNA name snR34
alias
chromosome ⁄ contig XII
locus ⁄ host gene Mono:30:snR34
organization Mono
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U2826,25S:U2880
accession no L33802,BK006945
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved