snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR3
sequence
AACTTTGTCCTAAAGTACTAATCCACCGCATTAGACAGTACGAAGATCGAGCTATTTAT
TTGAACACTCGGTCTTATTCGTGATAAGCGTAATGTGGAGAGATCAATTTCCGGGTCATT
TATAAGAACTCGAGTGGATTGCTAGTTGTTTTGATTAGCTGAATGAGACTCGAGTGTCAG
AAGATGACTATATTT
  Box motif
  Complementary to target RNA
length 194
organism Saccharomyces_cerevisiae
snoRNA name snR3
alias
chromosome ⁄ contig X
locus ⁄ host gene Mono:23:snR3
organization Mono
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U2129,25S:U2133,25S:U2264
accession no BK006943,K01091
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved