snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR47
sequence
ATATATGATGATATCCTATAACAACAACAACATGAATTTCTTCGTCCGAATCCTTTATA
GGTGGAAACAAACTTTGACAATAGCTTTTTAACACTGATA
  Box motif
  Complementary to target RNA
length 99
organism Saccharomyces_cerevisiae
snoRNA name snR47
alias
chromosome ⁄ contig IV
locus ⁄ host gene Mono:7:snR47
organization Mono
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 18S:A619,25S:A2220
accession no U56648,BK006938
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved