snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR83
sequence
ACCCAAAAACATCAAGAAAAGCCTTTCAATAAATTGCTCTTCTCTTGGCGAAAGAAAGC
GGGGGGCAAAAAGAATCACGGGACTTATGTTTCGGGATCTCTTTGTTTCTTCTTTTTTTC
CCGGAGAATAATTTTTTAGGACCAATTACCGTAGTTGCGACTACAACAATTGTTGTTCAT
ACCCCCACGATTTACTTTTTGAAAACTAGTTTTTGGAATAATAATGTTGTAAAATTTCCC
TTTTTCCACCCCGATTTGTATTTTATTTTTCGTTACAAAATTGGGACTAATATTAAGGGC
GACAGTT
  Box motif
  Complementary to target RNA
length 306
organism Saccharomyces_cerevisiae
snoRNA name snR83
alias RUF3
chromosome ⁄ contig XIII
locus ⁄ host gene Mono:32:snR83
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1290,18S:U1415
accession no BK005602,BK006946
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved