snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR31
sequence
GAAGCAAAATTACACCATGAGTTCCTATTAACGTCAGCCTCTTTTGTACTCATAATGTG
GCTTCGGATGTTTGATGGGCGTTGCTTCAGTGCGTACGGCTCATGGTAGATTAATTATTA
GAAAGATGTATCTCCAGCTGTTGATATTAGAGGGGGAAGCCTTTCTCTTTCACCTCGCCT
TTTTAAACACCTGATACAGTTGGTCATGATTCGTTCTACATTTTAA
  Box motif
  Complementary to target RNA
length 225
organism Saccharomyces_cerevisiae
snoRNA name snR31
alias
chromosome ⁄ contig XV
locus ⁄ host gene Mono:43:snR31
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U999
accession no BK006948,X72299
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved