snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR69
sequence
GTTTATGATGAGACCACGTCCTTAGTGACAATGCTATAAACCCAGCTCTTCGATTCGTT
TTTAATGAAAGGGAGAAGATTTTTTTGTCAAACGCTCTGAGT
  Box motif
  Complementary to target RNA
length 101
organism Saccharomyces_cerevisiae
snoRNA name snR69
alias
chromosome ⁄ contig XI
locus ⁄ host gene Mono:25:snR69
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:C2948
accession no AF064281,BK006944
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved