snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR37
sequence
AACATCAGTAGTGGTTAATACTATCTTTAGATAATATTAATTTCATTATACCATAGAAA
CCTAAAGATTAGGTTATTTTCGTTCTTCATGTTATGGAGTGTGAGTGATGAGGAGCTTGC
TCTTTTAAGCTCATATTACGTAATAAGTTAATACTGGAGCGAGAATAATTTAAATCATTT
CATCATAACCCATAGCTGAATGAACTTTGACTACTCCTAAACAAAGTAGTAACAATTTTC
ATTTCGTTTCCGGTTTCTTAGATCGAATATTATTCTGAGGAAATTCCCTGATTACATATC
AGGGAAAGGTTCGCGTTTTTAGAGAATTGCGTAATGCGATTTGAAAGTTTAAATTCCTAA
GCGACTCTTCTTCATGATAAGACAGTT
  Box motif
  Complementary to target RNA
length 386
organism Saccharomyces_cerevisiae
snoRNA name snR37
alias
chromosome ⁄ contig X
locus ⁄ host gene Mono:21:snR37
organization Mono
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U2944
accession no U16693,BK006943
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved