snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR53
sequence
TTTGATGATGATTACACTCCATGCTAATCATGAACGTGTTCGATGTAAATTTGAATACG
ATGATTAAAATTGTTGTTTACGCTTTCTGAAA
  Box motif
  Complementary to target RNA
length 91
organism Saccharomyces_cerevisiae
snoRNA name snR53
alias
chromosome ⁄ contig V
locus ⁄ host gene Poly:0:snR67
organization Poly
target RNA 18S rRNA
modification type C/D
modification site 18S:A796
accession no AF064265,BK006939
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved