snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR67
sequence
TAACATGATGACTAAGTTGTCGCCCCAAGCGGATCTTTGAAATGACTGATTTTACAAAC
AACAAACACTGAAAATTCTGAAA
  Box motif
  Complementary to target RNA
length 82
organism Saccharomyces_cerevisiae
snoRNA name snR67
alias
chromosome ⁄ contig V
locus ⁄ host gene Poly:0:snR67
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:G2619,25S:U2724
accession no AF064279,BK006939
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved