snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR68
sequence
TATCATGATGAGCATTTATTTTACTGCGTTATCGTATTGACGGGGGCTGTTTAAGTACA
GTCTGTTTTATAATCTATATTCATTTATATTTTATATTTCTTACCGAGGAAATTGACTCT
TAACAGATTTGCTGAAA
  Box motif
  Complementary to target RNA
length 136
organism Saccharomyces_cerevisiae
snoRNA name snR68
alias
chromosome ⁄ contig IX
locus ⁄ host gene Mono:10:snR68
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:A2640
accession no AF064280,BK006942
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved