snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR86
sequence
TAACCATTGATGAAATTCTATTGAATGTCCCCAATTTTCGGAAAAGGACTGCACCGAAA
TATTTCAATCAAAATCATTTATCGTTTTGTTTAGCTATTTTTTTCTCAAATTATCACTCT
TTTCTTCCTTTTTCATTCTCTCAATTGTTCTTTTTATTTGAGGAAATTTGATTGTATTGC
ATATACAACTATGCGATGCACTTTGTTCATTTTAACTTTGGATATATGTGCCTTGCTATG
AACGCGTTCATTTTTAAGTGACCGGACCCTAAAATATTCAGGTAGCATGACGGAAGCTAT
GAATTAATCCTGGTGGAGGGGTGTGTTCAGTTTGAGGGAGGATGATAAAATGGAACGGAG
ATTGCAAGGAGACGTAGAAAATAAAGTAGGAGCAAATGGATTTTCTGCTTGGCGGTATAG
CACGTTTGAGTTTTTCAGTCGTGTCTATGTTCAGGTTTATGATATGCTGTGGTTGATTCT
GTTGATTCACACGTTTCGCTTCCATATAGTGTGTTAACGGAAACTCCATGTTAAGGTTTA
TTATAAGAAAATTTTTTGAATTTGTTCTTTTTATATTGGTTTACTCTCCTCGTGATTTCT
TTTCTTTTTTTATCGTCATCCTCTCTGAATGTATTTATTACGCATGGCTTTTATTCATTG
CTTTCTAACTGTGATGGGAGTTTTTTTCTTGTTGCATAAATGAACGTGGGCGAGGTTTTT
ATTTTCAAACTTGGTGTACTATAGTGCAATGCGTTGTTAATTGTAATACGATGTTTCTTC
GATAAAAGGAGCGGAGGGAGAAGGTGAAATTACGAAGGAAAGAAAGAGATGAGAAATCAA
GAATGAAGCAAGACATTGATTGATATGGTTGTTTTCGGTGCATGTTTGATTACTAAAAGT
TGGGGCATTCGATGGTTTACAGAAGTCATAAATTCAAATATCCCGTTTAATCGCTCATCT
ATTAAAATCAATAGTAGAATGTAGTTTCATACCCGGGAGAAATTC
  Box motif
  Complementary to target RNA
length 1004
organism Saccharomyces_cerevisiae
snoRNA name snR86
alias
chromosome ⁄ contig XIII
locus ⁄ host gene Mono:34:snR86
organization Mono
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U2314
accession no BK006946
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved