snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR71
sequence
GTTATATGATGATAACCTTCTCAGCTCACTCAGATCTTTTGATATGATTGATAAAAATT
TCCTATCCAACATTCATCAATTTATCTGACC
  Box motif
  Complementary to target RNA
length 90
organism Saccharomyces_cerevisiae
snoRNA name snR71
alias
chromosome ⁄ contig VIII
locus ⁄ host gene Mono:20:snR71
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:A2946
accession no AF064283,BK006934
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved