snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR39b
sequence
ATTTAGTGATGATACTGCCGATTCTGGCATTCCAAAAAGTGACTAGCAAAATTGCGATG
TTGTCAACTTAAATTACACCATCTTTCGGGGCTGATA
  Box motif
  Complementary to target RNA
length 96
organism Saccharomyces_cerevisiae
snoRNA name snR39b
alias
chromosome ⁄ contig VII
locus ⁄ host gene Mono:16:snR39B
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:G805
accession no X94605,BK006941
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved