snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR80
sequence
GAACGTTTGACAACACTCTGGGACCAAGTTTCGATGGTTATTTTTTTATTTCCATCGAT
GTCTTTCACTGTACTTAGTTCCAATTTATATTGCAAACAAGATTAATTTAGGCGATTACT
CACTAAGATATACCTATTTCTACTATGGTTATATTAGTCCATTTCATAGCCT
  Box motif
  Complementary to target RNA
length 171
organism Saccharomyces_cerevisiae
snoRNA name snR80
alias
chromosome ⁄ contig V
locus ⁄ host gene Mono:11:snR80
organization Mono
target RNA 25S rRNA, 18S rRNA
modification type H/ACA
modification site 18S:U759,25S:U776
accession no BK006939,BK005599
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved