snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR57
sequence
AAGCGTGATTATAAAAAATGATTTAAATATTTTTCTGAGGAAGTATATGCAGGACATAT
TGTGAATTAGGAATTCTTCGTTTATGATC
  Box motif
  Complementary to target RNA
length 88
organism Saccharomyces_cerevisiae
snoRNA name snR57
alias
chromosome ⁄ contig XII
locus ⁄ host gene Poly:2:snR61
organization Poly
target RNA 18S rRNA
modification type C/D
modification site 18S:G1572
accession no AF064269,BK006945
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved