snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR10
sequence
AACGCAAATTTAACAGCCATTCGTAACACGTACAGTATCTCGTCGAGGTTGAACCCCTC
CGGGGCGTTCTTGACCCATGAAGAATGTGGATTGGTGTTGCAATATATTTATTATTGGCT
TGGACTGGAGAACAAATTTATCGATCTTGGGTGCAACAGTCTTTCTGTCGTCTGTTTTTT
AGCAGATCTAAGGGTTTACCTTCGTGTGCCCGGATGAGGACCGTTGCAAGGATTGATAAT
ACAACT
  Box motif
  Complementary to target RNA
length 245
organism Saccharomyces_cerevisiae
snoRNA name snR10
alias
chromosome ⁄ contig VII
locus ⁄ host gene Mono:15:snR10
organization Mono
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U2923
accession no X03372,BK006941
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved