snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR42
sequence
ATAACAATTTGTGATGCTTTAGGGAGCCTATTGTTTGATGGTTTATAGGAGCCGGATTT
GTCTTTTTGACTAATTTTCAACCTATTCTTACTTCCAAAACTGTTGCAATGGCTCTCGTT
TTTTTTAAATTTTTCTCTTTTCTCTTCTTTGGCATAGTTTATTTTTAATAAATTATTTCA
GGGTGAGATAGAGAAAGGATAATGAGTATCGTAGATAAATCTTCGGTTCCGAATAGTGTA
ACTGTTGGTGCTGAGGTAATCCATCTTTAAAACCATCGCCGTTAGAGGTTGCTTCTGATA
TTTTCGGTTAAGCGACCCATGAAATGGTGATGACCTGAGGTATGGAACATCT
  Box motif
  Complementary to target RNA
length 351
organism Saccharomyces_cerevisiae
snoRNA name snR42
alias
chromosome ⁄ contig XI
locus ⁄ host gene Mono:27:snR42
organization Mono
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U2975
accession no U56643,BK006944
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved