snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR189
sequence
AACAAAATAATTTACATTCCAAGGACCGGTATTATTGTAGGGGATTTGTGACTTTCAAG
GCAACGTCCTCTCTACAACCGAGTTCGAGAATAAGTACAAATGGCTCTTTTTGTTATTCG
AAAGCTTACAAGTTCTGGTATATTCTATATACTCACTTATTACTTTCAAGTACTTCACAC
GGGCCTGACATCT
  Box motif
  Complementary to target RNA
length 192
organism Saccharomyces_cerevisiae
snoRNA name snR189
alias
chromosome ⁄ contig III
locus ⁄ host gene Mono:5:snR189
organization Mono
target RNA 25S rRNA, 18S rRNA
modification type H/ACA
modification site 18S:U466,25S:U2735
accession no X06430,BK006937
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved