snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR82
sequence
ATGGCTCTTCAACACATTTCAACATGTTCAAGTAATTTGTGTTAGTGGATGACCATTTA
GGGGCTGCTGGCCTGGTTACCGGGAGTTTTTCTTGGATCCAAGCTAGCTTTTCCGTCTGA
TTATCCTTAAGCTTCACAAATTACAATTTTTCCCACGCATTAAGAAATAAGCTCAAGATG
CCTAAAATAAGTTCTATCCCGCCTTTTTTCGCTAACAATGACTGAGTATTCCCACAGTCT
ATAGTTTGATAGTAGATGGGCGGAAATTT
  Box motif
  Complementary to target RNA
length 268
organism Saccharomyces_cerevisiae
snoRNA name snR82
alias RUF2
chromosome ⁄ contig VII
locus ⁄ host gene Mono:14:snR82
organization Mono
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U1110,25S:U2349,25S:U2351
accession no BK005601,BK006941
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved