snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR48
sequence
TCATAATGATGATTTCACTTATACCTATATGTTTTTTCTGGCATCTCTAATGTTAGGAT
GTGAAGTTTAAGTACTCTCCATTCAATGAATACAATTTTTGACAATATCTGATT
  Box motif
  Complementary to target RNA
length 113
organism Saccharomyces_cerevisiae
snoRNA name snR48
alias
chromosome ⁄ contig VII
locus ⁄ host gene Mono:18:snR48
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:G2791,25S:G2793
accession no AF064261,BK006941
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved