snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR74
sequence
TGCAGAAGATGAAACAAATTACTCAAATAGACAAGCATATGTCTGATCTTCATGATTGA
AAAGAGCAATTAGTGTCTGATGCAATTTA
  Box motif
  Complementary to target RNA
length 88
organism Saccharomyces_cerevisiae
snoRNA name snR74
alias Z4
chromosome ⁄ contig XIII
locus ⁄ host gene Poly:3:snR78
organization Poly
target RNA 18S rRNA
modification type C/D
modification site 18S:A28
accession no AJ010797,BK006946
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved