snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR78
sequence
TCCCTTGATGACCAAAATAAATTTTTACAAACTAGAGTTTCTGAATCTTTTGTGATTAG
AACGTTTATTCTTATTTCTGAGGTTTTT
  Box motif
  Complementary to target RNA
length 87
organism Saccharomyces_cerevisiae
snoRNA name snR78
alias Z8
chromosome ⁄ contig XIII
locus ⁄ host gene Poly:3:snR78
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:U2421
accession no AJ010801,BK006946
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved