snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR49
sequence
ATGGGACTTTATCTCCATGACTATGCCATTTCTAGGTAGCCTATGGTAAACGAATCCCG
TAGATTATTCACACGTTTGTTGTCTTTGTTGACAACAACACAGAGTAAGAAAAAGCAAAA
GATTTATCTCTTTTGTCCATCTTTTTTTTATTTTGAAGGCGTGTAACATTT
  Box motif
  Complementary to target RNA
length 170
organism Saccharomyces_cerevisiae
snoRNA name snR49
alias
chromosome ⁄ contig XIV
locus ⁄ host gene Mono:36:snR49
organization Mono
target RNA 25S rRNA, 18S rRNA
modification type H/ACA
modification site 25S:U990,18S:U120,18S:U211,18S:U302
accession no AF085328,BK006947
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved