snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR36
sequence
TTGCCCTGTGCCTCGCTCGGTTGTTAATTGCCAATATTACGATCTTGAGCTGGATGACA
AAAAAATAAAAATACATTTTATTTTTTTGATCAACGGGCTAAAACAATTAGACTTCTTTG
AGTACGAGGATATCGCTATTTTTATCTCACGGTATCGTATTGTAATTAGAACGTCTCATA
TCA
  Box motif
  Complementary to target RNA
length 182
organism Saccharomyces_cerevisiae
snoRNA name snR36
alias
chromosome ⁄ contig XV
locus ⁄ host gene Mono:40:snR36
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1187
accession no L33804,BK006948
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved