snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR4
sequence
AACTATTACAGTCGATGAGGATAGGTTATAGTTCATGTGTAACATCTGTGTTTTAAAAT
AACTCTAGTTATCCGGGGCGTTTTTCACAAAGTTTGTGTAAGATGCTTTCCTGGGTCGAT
GTGGATTGTGCCGTGGCCTTTTTCACCACCTTTATAGCGGTGCTTTAACTATTAATAACT
GAGGCTG
  Box motif
  Complementary to target RNA
length 186
organism Saccharomyces_cerevisiae
snoRNA name snR4
alias
chromosome ⁄ contig V
locus ⁄ host gene Mono:12:snR4
organization Mono
target RNA Unknown
modification type C/D
modification site
accession no U57010,BK006939
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved