snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR81
sequence
AGGTTAGGGACTGCAAAAGAAGCGGCGAGGCAGCCCACATCAAGTGGAACTACACAGAC
TTCCTTGTCGCGATACTACGGTCCCAAGAGCAATCCTAACAAGCAATTACATATTCCCCC
GCTGAACCTGTACAGTCCACGGATGGTGCAGAAGTTATATGATTTGGGGGAAGACGCTTT
TTCACATCTTCTTGCATGATAA
  Box motif
  Complementary to target RNA
length 201
organism Saccharomyces_cerevisiae
snoRNA name snR81
alias
chromosome ⁄ contig XV
locus ⁄ host gene Mono:38:snR81
organization Mono
target RNA 25S rRNA, U2 snRNA
modification type H/ACA
modification site U2:U42,25S:U1052
accession no BK005600,BK006948
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved