snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR32
sequence
AACATCATAATTATATCGCGAATGTACTACTAGTATATGCAGTTTTCTTAAAATTGCAG
GGAATGACTAAAAGCCCACGTTTTTCCCACTTTTAGTAGTACTGAAGCGTAGATAGATTG
AACGTTGCTGGGCGCCTGGTGTTGATCATTTCTGAAATGAGATATTGGGAATCAGCTGTA
TCTACATTT
  Box motif
  Complementary to target RNA
length 188
organism Saccharomyces_cerevisiae
snoRNA name snR32
alias
chromosome ⁄ contig VIII
locus ⁄ host gene Mono:19:snR32
organization Mono
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U2191
accession no L22434,BK006934
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved