snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR43
sequence
CACTCCTGTTTCTGCCTCATGTCTTTTAAAACGCTTCCACGGGACATGGGTTCTAATTA
TGGAGAAGATCAAGCTTTGAAATGGCCCGTTTACACATTTTGATACAACCGTAGACGGCG
TCTCGTTTCAAAGACCGTGTGGTTGTCTATCAGTATATACTCATTGTGTTTTTCAAAAAA
TCTCTGGGTTGTTTAGATGCCACTATATTT
  Box motif
  Complementary to target RNA
length 209
organism Saccharomyces_cerevisiae
snoRNA name snR43
alias
chromosome ⁄ contig III
locus ⁄ host gene Mono:2:snR43
organization Mono
target RNA 25S rRNA, 5.8S rRNA
modification type H/ACA
modification site 5.8S:U73,25S:U966
accession no U56644,BK006937
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved