snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR60
sequence
TGTTAATGATGATAACCAAAGATGCATAGTTCAACTGATTGAACATACTATCGAAATGA
AGATAAAAATTTCCATCGAAATTAGTCTTTCGCTCCTATCTGAAC
  Box motif
  Complementary to target RNA
length 104
organism Saccharomyces_cerevisiae
snoRNA name snR60
alias Z15
chromosome ⁄ contig X
locus ⁄ host gene Mono:22:snR60
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:A817,25S:G908
accession no AF064272,BK006943
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved