snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR79
sequence
TTTAATGATGATAGCATGATTTATGTTGCTCGAAGTTAATCGATGTGAGCACAATGATT
TCTCAAGACTACAACGGTATCTGAAT
  Box motif
  Complementary to target RNA
length 85
organism Saccharomyces_cerevisiae
snoRNA name snR79
alias Z9
chromosome ⁄ contig XII
locus ⁄ host gene Mono:29:snR79
organization Mono
target RNA 18S rRNA
modification type C/D
modification site 18S:C1007
accession no AJ010802,BK006945
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved