snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR84
sequence
ATTGCACAACTTAAGTTTGTCGAGGATCATTTTTTTGAACTGAATCATGCTCTTTTTAA
GTGCTTTGAAACCCTCGATGAATGTGTCAATGTGCAAAGATAAACCATTGTTCTCTGTTG
ATCAGTGACTTAATGTTTGCTTTGGAGAATGATATTTTCCCTTTCCTATATTTGACTTTT
GTTCTAAAAGTTATTTGGAGAGAAAAGGCATGATTGAGGTTGCGACTTTTTCGTTTTTGC
TTTTGCATGGATAATTCATCCATGCACATCTCACTTTATTGGACCTTCAAGATTGGTTTC
CCATGTAATTTAATTTTCTCTCCTCTACATTTAATATGTTCTATATTAATTAATACCAAT
TGAGTTGTGCGTACTTCATTGCAGATATTTTACCAGACCTGTCTGAGTTTTTCGTTCAAG
TTTGGTTGAAATCGGCTTGAGGTATATGAACGTGGTTGGGATATGGAGATTGGGAGATCA
AAGAAGCGAAAATACCTGAGACAGTTTTTTTAAAAAAGAAGCTAAGGAACATGACTCAAA
GAGACACATTA
  Box motif
  Complementary to target RNA
length 550
organism Saccharomyces_cerevisiae
snoRNA name snR84
alias RUF1
chromosome ⁄ contig IV
locus ⁄ host gene Mono:9:snR84
organization Mono
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U2266
accession no BK006938
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved