snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR85
sequence
TACTAGCACATATGTCAAATTCCTAATTAACGTTTTTTATATTCATCGTTTCTTAGAGC
CGTAATTGTGCTGATATCAATATCAGGGAAGAACATACCATATAGAGGTGTCAAGTACAC
CGAACGATCGTGGTGCTCCCTCAGCCACGGGCGTGCTTGGACGCTATTCCCA
  Box motif
  Complementary to target RNA
length 171
organism Saccharomyces_cerevisiae
snoRNA name snR85
alias
chromosome ⁄ contig XIII
locus ⁄ host gene Mono:31:snR85
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1181
accession no BK005604,BK006946
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved