snOPY snoRNA Orthological Gene Database
Rattus_norvegicus SNORD102
sequence
AACTTAATGATGATTGTCTATTTGATTGCTTGATGCAATGTGAAAACCACATTTCACCG
GCTCTGAGAGTT
  Box motif
  Complementary to target RNA
length 71
organism Rattus_norvegicus
snoRNA name SNORD102
alias
chromosome ⁄ contig 12
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved