snOPY snoRNA Orthological Gene Database
Rattus_norvegicus SNORA17
sequence
CCTCCCCCTAGAGTAATTGCAGGTGTGACTGCTATGTCACGTGTGTGTCAGTAGGTGGC
AGAGAAGAGAGAGGCTATGTCTGATTGCTTAGTAGCCTAACATC
  Box motif
  Complementary to target RNA
length 103
organism Rattus_norvegicus
snoRNA name SNORA17
alias
chromosome ⁄ contig 13
locus ⁄ host gene 4921528O07Rik
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved