snOPY snoRNA Orthological Gene Database
Rattus_norvegicus SNORD73
sequence
AATGAGTGATGACAGGATGTTTCGGTCCCATATGAATCCTACTGATTTCACCGATAACA
TTTCTTGCTGACATT
  Box motif
  Complementary to target RNA
length 74
organism Rattus_norvegicus
snoRNA name SNORD73
alias
chromosome ⁄ contig 2
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no AC_000070.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved