snOPY snoRNA Orthological Gene Database
Rattus_norvegicus SNORD98
sequence
GAGTTATGATGTGTAAATCCTATTCCATTGCTGAAATGCAGTGTGGAACATGATGAACT
GAACTC
  Box motif
  Complementary to target RNA
length 65
organism Rattus_norvegicus
snoRNA name SNORD98
alias
chromosome ⁄ contig 20
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no AC_000088.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved