snOPY snoRNA Orthological Gene Database
Rattus_norvegicus SNORA73
sequence
CCAACGTGGCCATCCCGGGAGGTCACTTTCCCCGGGCTCTGTCCTAGTGGCGTATGGGA
GCATAGGGTACTGCCCGATGATGTACAGTCCCTTTCCACAATGTTGGAGATGAAGCTGGG
CTTCGAGTCTGCGCCTGCATATTCCTACGACCTCTCAGAGTCCCGTGGACAGTGACTGAG
GAGACAAACCATGCAGGAAACAAAA
  Box motif
  Complementary to target RNA
length 204
organism Rattus_norvegicus
snoRNA name SNORA73
alias
chromosome ⁄ contig 3
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site
accession no AC_000071.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved