snOPY snoRNA Orthological Gene Database
Rattus_norvegicus SNORA52
sequence
TGGTTATGGCTGATCAGCCCGTGATCTGCCAGGCTTTGCTTGTGGACCAGAGCATCCTA
GAAACCTCGCCAGAGTTGCGCAAGGCCTTTTTGTTTTACGCTTGTGCCAGCAGCACTTCT
GAACATAC
  Box motif
  Complementary to target RNA
length 127
organism Rattus_norvegicus
snoRNA name SNORA52
alias
chromosome ⁄ contig 4
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site
accession no AC_000072.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved