snOPY snoRNA Orthological Gene Database
Rattus_norvegicus SNORA18
sequence
GTTGAGCTCTATCCCAGGGCTTCTCCTATAGCTGCACATTGTTGGAAACCCCTCATACA
GTAACTGATTTTGTATCACATACGGGACTGCTTCCCAGGTCTGTGGGAAGGGACTGCATG
ACGGCA
  Box motif
  Complementary to target RNA
length 125
organism Rattus_norvegicus
snoRNA name SNORA18
alias
chromosome ⁄ contig 5
locus ⁄ host gene NP_001101444.1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no AC_000073.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved