snOPY snoRNA Orthological Gene Database
Rattus_norvegicus SNORA21
sequence
CCCTTTTTAAAAGCATTCAGTGGCCTTTTGCTAGTGACCCACTGAGCCATCCTGAAGGG
GCAGAGTGAAAACATCACTTTTGGGAGAAGTGGTAACGCGCTGTTTGCTTCAGTCAATGT
TGTGACAAGA
  Box motif
  Complementary to target RNA
length 129
organism Rattus_norvegicus
snoRNA name SNORA21
alias
chromosome ⁄ contig 6
locus ⁄ host gene Cpsf3
organization Intronic
target RNA
modification type H/ACA
modification site
accession no AC_000074.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved