snOPY snoRNA Orthological Gene Database
Rattus_norvegicus SNORA2
sequence
TTGGCCCTGAATCAAGGCCAGCAGTTTGCTGAAGCTGTTGGTTTCAAGCAGGTGCCTAA
ATAAATGTCTTTCTATGGTCTGTTGGCCATTTCAGAAATTTAAAAATGTAATGGTCAATT
CATTAGAAAGAAACATCT
  Box motif
  Complementary to target RNA
length 137
organism Rattus_norvegicus
snoRNA name SNORA2
alias
chromosome ⁄ contig 7
locus ⁄ host gene RGD1303127
organization Intronic
target RNA
modification type H/ACA
modification site
accession no AC_000075.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved