snOPY snoRNA Orthological Gene Database
Rattus_norvegicus SNORA44
sequence
AAGCATGTTTCCAAGGGCTGTGGCTGCTCATAGCCATGGGATCTCCAACTGCATGCCAG
AGTAACGGAGAGACTTTGACAGCCCAGGTTATCACAGTGCCTGCTGTTGCCACTCAGCTC
TCCTATATGT
  Box motif
  Complementary to target RNA
length 129
organism Rattus_norvegicus
snoRNA name SNORA44
alias
chromosome ⁄ contig 7
locus ⁄ host gene Polr3h_predicted
organization Intronic
target RNA
modification type H/ACA
modification site
accession no AC_000075.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved