snOPY snoRNA Orthological Gene Database
Rattus_norvegicus SNORD32
sequence
ATGACAGCAATGAGCAATAATCACCATCTTTGAGTTTCATGACTATGAAGCCAACTCAT
GCACAACTCTAAGACCT
  Box motif
  Complementary to target RNA
length 76
organism Rattus_norvegicus
snoRNA name SNORD32
alias
chromosome ⁄ contig 7
locus ⁄ host gene RGD1305976_predicted
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved