snOPY snoRNA Orthological Gene Database
Rattus_norvegicus SNORD37
sequence
ACACATGATGACGGAAATTCTTCACTTTGACCTGATGTCTGTTGAAGAAACTCAGTGTC
TGAGG
  Box motif
  Complementary to target RNA
length 64
organism Rattus_norvegicus
snoRNA name SNORD37
alias
chromosome ⁄ contig 7
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no AC_000075.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved