snOPY snoRNA Orthological Gene Database
Rattus_norvegicus SNORA61
sequence
ACTCTCTGCCTCTTTCTCCCATTGGACGGTGACCCTGACTCTGGTTTTGGTGGTTGTAA
AAGAGGAAGAATATACTAAGTTTCACAGCACTGCAGTCTGGTGCAGAGCACAGAGCCAGA
TTCACACCAGG
  Box motif
  Complementary to target RNA
length 130
organism Rattus_norvegicus
snoRNA name SNORA61
alias
chromosome ⁄ contig 8
locus ⁄ host gene Unc13c
organization Intronic
target RNA
modification type H/ACA
modification site
accession no AC_000076.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved