snOPY snoRNA Orthological Gene Database
Rattus_norvegicus SNORD50
sequence
AATTAATGATGATCCTATCCTGAATCTGAATTCCTGTTGGAAAACCATAATTACGGATC
TGGCCTCTGAGAT
  Box motif
  Complementary to target RNA
length 72
organism Rattus_norvegicus
snoRNA name SNORD50
alias
chromosome ⁄ contig 13
locus ⁄ host gene Mono:503:SNORD50
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved