snOPY snoRNA Orthological Gene Database
Rattus_norvegicus SNORD25
sequence
ATGCCCTATGATGAGGACCTTTTCACAGACCTGTACTGATCTCTGTGAGGATAAGTAAC
TCTGAGGAGGC
  Box motif
  Complementary to target RNA
length 70
organism Rattus_norvegicus
snoRNA name SNORD25
alias
chromosome ⁄ contig 1
locus ⁄ host gene Mono:611:SNORD25
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved