snOPY snoRNA Orthological Gene Database
Rattus_norvegicus SNORD22
sequence
TCCCTATGAAGATATTTCACACGTCTTACTTCCTGTCCTAGCTCCAGAGCCTGAAAAGA
CGAACCCACTGGGGCTGGCTGGGGGAAAAGAGGACGTTTTGTTCCAGAAGGAACTGTCTA
ATGGAT
  Box motif
  Complementary to target RNA
length 125
organism Rattus_norvegicus
snoRNA name SNORD22
alias
chromosome ⁄ contig 11
locus ⁄ host gene Mono:527:SNORD22
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved